Hostname: page-component-7b9c58cd5d-hxdxx Total loading time: 0 Render date: 2025-03-15T01:54:34.553Z Has data issue: false hasContentIssue false

Use of histopathology, PCR and in situ hybridization methods to detect the parasite Mikrocytos sp. in Pacific oyster Crassostrea gigas from the northern coast of the Yellow Sea, China

Published online by Cambridge University Press:  17 March 2010

Zhongwei Wang
Affiliation:
Environmental Science and Engineering College, Dalian Maritime University, Dalian 116026, PR China
Yubo Liang
Affiliation:
Marine Environmental Ecology Department, National Marine Environmental Monitoring Center, Dalian 116023, PR China
Xin Lu
Affiliation:
Life Science and Technology College, Dalian Fisheries University, Dalian 116023, PR China
Get access

Abstract

Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.

Type
Note
Copyright
© EDP Sciences, IFREMER, IRD, 2010

Access options

Get access to the full version of this content by using one of the access options below. (Log in options will check for institutional or personal access. Content may require purchase if you do not have access.)

References

Bower, S.M., 1988, Circumvention of mortalities caused by Denman Island oyster disease during mariculture of Pacific oysters. Am. Fish. Soc. Spec. Publ. 18, 246248.
Bower, S.M., McGladdery, S.E., Price, I.M., 1994, Synopsis of infectious diseases and parasites of commercially exploited shellfish. R. Ann. Rev. Fish Dis. 4, 1223.
Bower, S.M., Hervio, D., Meyer, G.R., 1997, Infectivity of Mikrocytos mackini, the causative agent of Denman Island disease in Pacific oysters Crassostrea gigas, to various species of oysters. Dis. Aquat. Org. 29, 111116. CrossRef
Bower S.M., 2001, Hazards and risk management of Mikrocytos mackini in oysters. In: Rodgers C.J. ( ed.) Proc. OIE international conference on risk analysis in aquatic animal health, World organisation for animal health (OIE), Paris, pp. 164–166.
Bower, S.M., Bate, K., Meyer, G.R., 2005, Susceptibility of juvenile Crassostrea gigas and resistance of Panope abrupta to Mikrocytos mackini. J. Invertebr. Pathol. 88, 9599. CrossRef
Burreson, E.M., Ford, S.E., 2004, A review of recent information on the Haplosporidia, with special reference to Haplosporidium nelsoni (MSX disease). Aquat. Living Resour. 17, 499517. CrossRef
Carnegie, R.B., Meyer, G.R., Blackbourn, J., Cochennec-Laureau, N., Berthe, F.C.J., Bower, S.M., 2003, Molecular detection of the oyster parasite Mikrocytos mackini, and a preliminary phylogenetic analysis. Dis. Aquat. Org. 54, 219227. CrossRef
Gagné, N., Cochennec, N., Stephenson, M., McGladdery, S., Meyer, G.R., Bower, S.M., 2008, First report of a Mikrocytos-like parasite in European oysters Ostrea edulis from Canada after transport and quarantine in France. Dis. Aquat. Org. 80, 2735. CrossRef
Hervio, D., Bower, S.M., Meyer, G.R., 1996, Detection, isolation and experimental transmission of Mikrocytos mackini, a microcell parasite of Pacific oysters Crassostrea gigas (Thunberg). J. Invertebr. Pathol. 67, 7279. CrossRef
Littlewood, D.T.J., Ford, S.E., 1990, Physiological responses to acute temperature in oysters, Crassostrea virginica (Gmelin, 1971), parasitized by Haplosporidiun nelsoni (MSX) (Haskin, Stauber and Mackin, 1966). J. Shellfish Res. 4, 159163.
Lapègue S., Boudry P., Goulletquer P., 2007, Pacific cupped oyster-Crassostrea gigas. In: Svasand T, Crosetti D, Garcia-Vazquez E, Verspoor E (eds.) Genetic impact of aquaculture activities on native populations. Genimpact final scientific report (EU contract RICA-CT-2005-022802), pp. 76–82.
Ma, S.S., Zhou, S.L., Chen, J.F., Xin, F.Y., Cui, Y., Chen, B.J., Yu, H.T., Sun, K.Y., 1997, Study on the mortality of beach culture oyster and the ecological environment effect. J. Mar. Fish. Res. 18, 14-19 (Chinese with English abstract).
Meyer, G.R., Bower, S.M., Carnegie, R.B., 2005, Sensitivity of a digoxigenin-labelled DNA probe in detecting Mikrocytos mackini, causative agent of Denman Island disease (mikrocytosis) in oysters. J. Invertebr. Pathol. 88, 8994. CrossRef
OIE (World organisation for animal health), 2006, Aquatic animal health code and manual of diagnostic tests for aquatic animals. Paris.
Quayle, D.B., 1961, Denman Island oyster disease and mortality, 1960, Fish Res. Board Can. Manuscr. Rep. Ser. 713, 19.
Quayle, D.B., 1982, Denman Island oyster disease 1960. British Columbia Shellfish Mariculture Newsletter 2, 1.
Stokes, N.A., Burreson, E.M., 1995, A sensitive and specific DNA probe for the oyster pathogen Haplosporidium nelsoni. J. Eukaryot. Microbiol. 42, 350357. CrossRef
Sui, X.L., Sun, J.W., Wang, F.G., Wang, J., Wang, J., Hu, Q.M., Xue, K., Wang, X.Y., Wang, Z.S., 2002, Reasons of mass death-off in Pacific oyster cultured in Dalian seashore. J. Dalian Fisheries University. 17, 272-278 (Chinese with English abstract).